scoC [2019-07-11 10:17:55]

transcriptional repressor of genes expressed in the transition phase

Locus: BSU09990

Isoelectric point: 5.19

Molecular weight: 23.57 kDa

Protein length: 203 aa

Gene length: 612 bp

Function: transition state regulator

Product: transcriptional repressor (MarR family)

Essential: no

Synonyms: hpr,catA

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other
• Information processing → Regulation of gene expression → Transition state regulators
• Groups of genes → Phosphoproteins → Phosphorylation on an Arg residue

Gene

Coordinates: 1,073,106 → 1,073,717

The protein

Modification

• phosphorylated on Arg-3 PubMed

Effectors of protein activity

• activity is inhibited in an unknown way by PrkA (possibly phosphorylation) PubMed

Structure

• 2FXA

Additional information

• information on binding sites can be found in the PRODORIC2 database

Expression and Regulation

Operons

• Genes: scoC
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • AbrB: activation, PubMed, in AbrB regulon
  • SenS: positive regulation, in SenS regulon
  • SalA: negative regulation, in SalA regulon
  • CodY: negative regulation, in CodY regulon

  Regulation

  • expressed upon transition into the stationary phase (AbrB) PubMed

Biological materials

Mutant

• 1A918 ( scoC::erm trpC2 leuC7), PubMed, available at the Bacillus Genetic Stock Center
• BKE09990 (ΔscoC::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTACGTCACCTGCTTCTC, downstream forward: _UP4_GAAGAGCTCGAACCTGTAAA
• BKK09990 (ΔscoC::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTACGTCACCTGCTTCTC, downstream forward: _UP4_GAAGAGCTCGAACCTGTAAA

Expression vectors

• for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Gerth lab

References

Reviews

Loading

Original publications

Loading